View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3157_low_13 (Length: 209)
Name: NF3157_low_13
Description: NF3157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3157_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 190
Target Start/End: Original strand, 23056903 - 23057084
Alignment:
| Q |
9 |
agagaagaagataaggtggtggtggtatgaccagagaagaaaaggaggcaaggtggttggagaagatgaggtggggtggtgaggatggaagagtttgagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
23056903 |
agagaagaagataaggtggtggtggtatgaccagagaagaaaaggaggcaaggtggtcggagaagatgaggtggggtggtgaggatggaaaaatttgagt |
23057002 |
T |
 |
| Q |
109 |
agattcgatggtgggggtgaacgacggtggtgaggagaaggatgggtgatgatggtgtttgattcagtgggtatggtggcca |
190 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
23057003 |
agatccggtggtgggggtgaacgacggtggtgaggagaaggatgagtgatgatggtgtttgattcggtgggtacggtggcca |
23057084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 61 - 159
Target Start/End: Complemental strand, 38336909 - 38336812
Alignment:
| Q |
61 |
gtggttggagaagatgaggtggggtggtgaggatggaagagtttgagtagattcgatggtgggggtgaacgacggtggtgaggagaaggatgggtgatg |
159 |
Q |
| |
|
|||||| || || ||||||||||||||||| |||||| ||||||||| ||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
38336909 |
gtggttagaaaatatgaggtggggtggtgatgatggattgatttgagtagtttcgatggtgggg-tgaacggcggtggtgaagagaaggatgggtgatg |
38336812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University