View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_10 (Length: 328)
Name: NF3158_low_10
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 177 - 309
Target Start/End: Complemental strand, 12812739 - 12812607
Alignment:
| Q |
177 |
accaccatagcctcctccagctccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812739 |
accaccatagcctcctccagctccacctcctttgccacctccgtagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcct |
12812640 |
T |
|
| Q |
277 |
tcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
12812639 |
tcaccacctccatagccagaatcaccatgctct |
12812607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 177 - 309
Target Start/End: Complemental strand, 12749647 - 12749515
Alignment:
| Q |
177 |
accaccatagcctcctccagctccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcct |
276 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | | | ||||||||||| |
|
|
| T |
12749647 |
accaccataacctcctccagctccacctcctttgccacctccgtagccagactcgccatgctctcccccaccagcttttttttttttttccccacctcct |
12749548 |
T |
|
| Q |
277 |
tcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12749547 |
tcaccgcctccatagccagaatcaccatgctct |
12749515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 177 - 309
Target Start/End: Complemental strand, 12749716 - 12749584
Alignment:
| Q |
177 |
accaccatagcctcctccagctccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| | ||||||||| |||||||| | |||||||||||||| ||||||||| |
|
|
| T |
12749716 |
accaccatagcctcctccagctccacctccttcaccacctccgtagccagaagcaccatgctctaccccaccaccataacctcctccagctccacctcct |
12749617 |
T |
|
| Q |
277 |
tcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
| || ||||| |||||||| || ||||||||| |
|
|
| T |
12749616 |
ttgccacctccgtagccagactcgccatgctct |
12749584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 177 - 309
Target Start/End: Complemental strand, 12812808 - 12812676
Alignment:
| Q |
177 |
accaccatagcctcctccagctccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| | |||||||||||||||||| | || ||||||||||| ||||||||| |
|
|
| T |
12812808 |
accaccatagcctcctccagctccacctccttcaccacctccgtagccagaagcaccatgctctcccccaccaccatagcctcctccagctccacctcct |
12812709 |
T |
|
| Q |
277 |
tcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
| || ||||| |||||||| || ||||||||| |
|
|
| T |
12812708 |
ttgccacctccgtagccagactcgccatgctct |
12812676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 275
Target Start/End: Complemental strand, 12812660 - 12812572
Alignment:
| Q |
187 |
cctcctccagctccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcc |
275 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| || |||||||||||||||||| | |||||||||||||| ||| |||| |
|
|
| T |
12812660 |
cctcctccagccccacctccttcaccacctccatagccagaatcaccatgctctcccccaccaccataacctcctccagcgccagctcc |
12812572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 232 - 309
Target Start/End: Complemental strand, 12749730 - 12749653
Alignment:
| Q |
232 |
ccatgctctcccccaccagcgtaacctcctccagccccacctccttcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||| |||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
12749730 |
ccatgctctcccccaccaccatagcctcctccagctccacctccttcaccacctccgtagccagaagcaccatgctct |
12749653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 232 - 309
Target Start/End: Complemental strand, 12812822 - 12812745
Alignment:
| Q |
232 |
ccatgctctcccccaccagcgtaacctcctccagccccacctccttcaccgcctccatagccagaatcaccatgctct |
309 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||| |||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
12812822 |
ccatgctctcccccaccaccatagcctcctccagctccacctccttcaccacctccgtagccagaagcaccatgctct |
12812745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 275
Target Start/End: Complemental strand, 12749556 - 12749480
Alignment:
| Q |
199 |
ccacctcctttgccacctccatagccagactcgccatgctctcccccaccagcgtaacctcctccagccccacctcc |
275 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||||||||||||||||| | |||||||||||||| ||| |||| |
|
|
| T |
12749556 |
ccacctccttcaccgcctccatagccagaatcaccatgctctcccccaccaccataacctcctccagcgccagctcc |
12749480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University