View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_12 (Length: 302)
Name: NF3158_low_12
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 29551339 - 29551401
Alignment:
| Q |
101 |
gaaaatgttgagtaaattgattaatttagtctaaattttaaatcatatgcatcaatttttagt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29551339 |
gaaaatgttgagtaaattgattaatttagtctaaattttaaatcatatacatcaatttttagt |
29551401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 160 - 255
Target Start/End: Original strand, 29551454 - 29551549
Alignment:
| Q |
160 |
tagttacatttataactatctgtttctcttcgaaaattgatgatattatcgtttcaagagtttaacttaagcaaccaatcaagacacacccattga |
255 |
Q |
| |
|
|||||||||||| |||||| ||||||||| || ||||||| |||| || |||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29551454 |
tagttacatttacaactatacgtttctctttgagaattgataatatcattgtttcaagagttcaacttaagtaaccaatcaagacacacccattga |
29551549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 29551255 - 29551283
Alignment:
| Q |
17 |
taattacttcccttactcaatacgtgagc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29551255 |
taattacttcccttactcaatacgtgagc |
29551283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University