View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_16 (Length: 261)
Name: NF3158_low_16
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 53795671 - 53795791
Alignment:
| Q |
17 |
agtaatgatattcttaaagaaaataaaagctggtggccatatcctgtcaggtgatgcagaaacaaataaacatttcaaataaggggcattatattgtagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
53795671 |
agtaatgatattcttaaagaaaataaaagctggtggccatatcctgtcaggtgatgcagaaacaaataaacatttcaaatcagtggcattatattgtagt |
53795770 |
T |
 |
| Q |
117 |
taaaagttaaaa-ttaaaatt |
136 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
53795771 |
taaaagttaaaagttaaaatt |
53795791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 146 - 253
Target Start/End: Original strand, 53795863 - 53795970
Alignment:
| Q |
146 |
attgatatagtacgcgcaaacaacagttacgagtggattttgatttaggtcaacacttccacataacattgcattttttagggctcaaatcaattttgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53795863 |
attgatatagtacgcgcaaacaacagttacgagtggattttgatttaggtcaacacttccacataacagtgcattttttagggctcaaatcaattttgct |
53795962 |
T |
 |
| Q |
246 |
ttcttatc |
253 |
Q |
| |
|
|||||||| |
|
|
| T |
53795963 |
ttcttatc |
53795970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University