View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_19 (Length: 239)
Name: NF3158_low_19
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 43484945 - 43485165
Alignment:
| Q |
19 |
gacttgtcacgtgtatttgatcaaagaagcagcattgtggtgtggagctctgaataaaaagagaaatactcaaaccaagccgggacctgcttttcgaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43484945 |
gacttgtcacgtgtatttgatcaaagaagcagcattgtggtgtggagctctgaataaaaagagaaatactcaaaccaagccgggacctgcttttcgaaac |
43485044 |
T |
|
| Q |
119 |
acaaatttgatagatttataataattatgaaagaccttcattaggtcaatgttgttgtagactcaggcatgttttagggaacattttcattgctttttgt |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43485045 |
acaaattttatagatttataataattatgaaagaccttcattaggtcaatgttgttgtagactcaggcatgttttagggaacattttcattgctttttgt |
43485144 |
T |
|
| Q |
219 |
ttttcatccttcatcttgctt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43485145 |
ttttcatccttcatcttgctt |
43485165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University