View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_20 (Length: 232)
Name: NF3158_low_20
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 44694163 - 44694397
Alignment:
| Q |
1 |
tgaggcgatcaaacaagtcctccatgttttccagattcataggtagctccgccagaaacaattgccttgcag---tcaacgacgcctttaccgcggagaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
44694163 |
tgaggcgatcaaacaagtcctccatgttttccagattcataggtagctccgccagaaacaattgccttgcagcagtcaacgacgccttcaccgcggagaa |
44694262 |
T |
|
| Q |
98 |
tgcagacagagctgtgaaagaaggagatggacaaaatgggaactgggttttcaaggtttttgatcttaattctgtttggaaaggtgaacaagagagtggt |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44694263 |
tgcagacagaactgtgaaagaaggagatggacaaaatgggaactgggttttcaaggtttttgatcttaattctgtttggaaaggggaacaagagagtggt |
44694362 |
T |
|
| Q |
198 |
gataacgacgaagatgaatgtgatgtttgtagagt |
232 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
44694363 |
gataacgacggagatgaatgtgatgtttgtagagt |
44694397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University