View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3158_low_21 (Length: 229)
Name: NF3158_low_21
Description: NF3158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3158_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 212
Target Start/End: Original strand, 55297722 - 55297920
Alignment:
| Q |
14 |
agaagaagaaggaggaggaggatgagcgcggtgaatatcacgaacgtgacggtcctcgacaatccagcttcgtttctcaatccctttcagttcgagattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55297722 |
agaagaagaaggaggaggaggatgagcgcggtgaatatcacgaacgtgacggtcctcgacaatccagcttcgtttctcaatccctttcagttcgagattt |
55297821 |
T |
|
| Q |
114 |
cctatgagtgtttggccgctctcaaagatggtatcgtttctctttactctactacttttctaacctaattcatttcttcatttatcttgctttagatct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55297822 |
cctatgagtgtttggccgctctcaaagatggtatcgtttctctttactctactacttttctaacctaattcatttcttcatttatcttgctttagatct |
55297920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University