View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3160_high_15 (Length: 222)
Name: NF3160_high_15
Description: NF3160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3160_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 3828833 - 3828649
Alignment:
| Q |
19 |
aattatgggattcaattaggtttggatgaaatgaaggtacttttgtaatttgcgatagtaaagtatcagtaaaacttgaaggaaaattctactgaacaac |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3828833 |
aattatgggattcaattaggtt-ggatgaaatgaaggtacttttgtaatttgtgatagtaaagtatcactaaaacttgaaggaaaattctactgaacaat |
3828735 |
T |
|
| Q |
119 |
tattagacctgcattgttgtattgcggaatggtgaacaagtaaaagactaaaagaaaataagattggtgttgccaagatgagactg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3828734 |
tattagacctgcattgttgtattgcggaatggtgaacaagtaaaagactaaaagaaaataagattggtgttgccaagatgagactg |
3828649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 3842406 - 3842222
Alignment:
| Q |
19 |
aattatgggattcaattaggtttggatgaaatgaaggtacttttgtaatttgcgatagtaaagtatcagtaaaacttgaaggaaaattctactgaacaac |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3842406 |
aattatgggattcaattaggtt-ggatgaaatgaaggtacttttgtaatttgtgatagtaaagtatcactaaaacttgaaggaaaattctactgaacaat |
3842308 |
T |
|
| Q |
119 |
tattagacctgcattgttgtattgcggaatggtgaacaagtaaaagactaaaagaaaataagattggtgttgccaagatgagactg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3842307 |
tattagacctgcattgttgtattgcggaatggtgaacaagtaaaagactaaaagaaaataagattggtgttgccaagatgagactg |
3842222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University