View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3160_high_7 (Length: 349)
Name: NF3160_high_7
Description: NF3160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3160_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 104 - 330
Target Start/End: Original strand, 15020637 - 15020862
Alignment:
| Q |
104 |
actgaaaattgaccttaaaattttgatcattaacattgttattattagtaccaaacaaagaactgttccaacaaatctggatgtatggaaaattccaatt |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15020637 |
actgaaaattgaccttaaaattatgatcattaacattgttattattagtaccaaacaaagaactgttccaacaaatctggatgtatggaaaattccaatt |
15020736 |
T |
 |
| Q |
204 |
atgctgagcttctgacatgtgtactcattcacgagagattcaagtgttactcttctttgtggtggatacaagatggaaattgggaggcatgagagggttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15020737 |
atgctgagcttctgacatgtgtactcattcacgagagattcaagtgttacatttc-ttgtggtggatacaagatggaaattgggaggcatgagagggatt |
15020835 |
T |
 |
| Q |
304 |
tgtttcttttaatgagacacaaaggtt |
330 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15020836 |
tgtttcttttaatgagacacaaaggtt |
15020862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 75
Target Start/End: Original strand, 15020545 - 15020605
Alignment:
| Q |
14 |
agagccaggccctcagggagggtacatctgaatttttgttggaacataacatgccaactcac |
75 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15020545 |
agaggcaggccctcagggagggtacatctgaa-ttttgttggaacataacatgccaactcac |
15020605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University