View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3160_low_13 (Length: 263)
Name: NF3160_low_13
Description: NF3160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3160_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 7692360 - 7692104
Alignment:
| Q |
1 |
tatgtctcaaaaaagttgggccaaacacctaataatgtcatcgtcatggatatgagctttgtgcagccacaatcatgtgactgaaatgcatctcggccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7692360 |
tatgtctcaaaaaagttgggccaaacacctaataatcttatcgtcatgggtatgagctttgtgcagccacaatcatgtgactgaaatgcatctcggccat |
7692261 |
T |
|
| Q |
101 |
ttgatcaaaggtcagacggtctagatgtaaagctcgatattttggattttaac-nnnnnnncaaattttggacaatctaatcttaattggacatacaaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7692260 |
ttgatcaaaggtcagacggtctagatgtaaagctcgatattttggattttaacaaaaaaaacaaattttggacaatctgatcttaattggacatacaaga |
7692161 |
T |
|
| Q |
200 |
tgcgtgtgactttgtgtagttacgtttcacctaatccaaatccataatttcatctca |
256 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7692160 |
tgtgtgtgactttgtgtagttacgttgcacctaatccaaatccataatttcatctca |
7692104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University