View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3160_low_16 (Length: 228)
Name: NF3160_low_16
Description: NF3160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3160_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 42247287 - 42247429
Alignment:
| Q |
15 |
ttattctatttggttattctcggttttttgtacattcaggataagttaaactggtgttcgatcagaagtagtttagttattgataaatcattccatttaa |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42247287 |
ttattctgtttggttattctcggttttttgtacattcaggataagttaaactggtgttcaatcagaagtagtttagttattgataaatcattccatttaa |
42247386 |
T |
 |
| Q |
115 |
ggatagtcaacgaaatgatcaagtggtttatggaactatattg |
157 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42247387 |
ggatagtcaacgaaatgatcaagtgttttatggaactatattg |
42247429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 42247425 - 42247460
Alignment:
| Q |
175 |
tattgaatagtacgtaccattgtaagttccactcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42247425 |
tattgaatagtacgtaccattgtaagttccactcat |
42247460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University