View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3161_high_5 (Length: 271)
Name: NF3161_high_5
Description: NF3161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3161_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 255
Target Start/End: Original strand, 3455658 - 3455892
Alignment:
| Q |
21 |
accaagaatttcaagtactattaagttccacttgaggttgaggaaccaatatatgaaattaatattcgaaatataagtcagatgataattaatgaagaat |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3455658 |
accaagaatttcaagtactatcaagttccacttgaggttgaggaaccaatatatgaaattaatattcgaaatataagtcagatgataattaatgaagaat |
3455757 |
T |
|
| Q |
121 |
aaaaggatctctttgaaaattgttgcaatgatttttctgaggttatttaagattttagtccataacatttgagtgcgttttaattttagtctcttgacac |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3455758 |
aaaaggatctctttgaaaattattgcaatgatttttctgaggttatttaagattttagtccctaacatttgagcgcgttttgattttagtctcttgacat |
3455857 |
T |
|
| Q |
221 |
ctcatctgcacctttgcaacttaagattcaatcat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3455858 |
ctcatctgcacctttgcaacttaagattcaatcat |
3455892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University