View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3161_low_17 (Length: 215)
Name: NF3161_low_17
Description: NF3161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3161_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 8418671 - 8418854
Alignment:
| Q |
20 |
cggatgtctaagaatcattttccttttatttattaaacaatagaggagtcaatttttcttttattataaaagtaatgttattcattcaaattgaaatagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8418671 |
cggatgtctaagaatcattttccttttatttattaaacaatagaggagtcaatttttcttttattataaaagtaatgttattcattcaaattgaaatagt |
8418770 |
T |
|
| Q |
120 |
atatcagaaataaacatggatgtaacatcgct---nnnnnnnntctgcgaacaaatcaaagtaatagaaatattcatgcctatg |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8418771 |
atatcataaataaacatggatgtaacatccctaaaaaaaaaaatctgcgaacaaatcaaagtaatagaaatattcatgcctatg |
8418854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University