View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3161_low_9 (Length: 250)
Name: NF3161_low_9
Description: NF3161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3161_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 10006530 - 10006305
Alignment:
| Q |
18 |
ggattcaaggtagctttcttcccatactcttttttgctcgcccatgtgnnnnnnnaacttaattttggccttttggcgcacatgattttcataaatgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10006530 |
ggattcaaggtagctttcttcccatactcttttttgcttgcccatgtgtttttttaacttaattttggccttttggcgcacatgattttcataaatgtct |
10006431 |
T |
 |
| Q |
118 |
ttatcttatatgtcgtgtttagttaatgtaatttttgtgggctaccagcctaccactgatgtatattcaaatagttggagggtgttgtttgcttttgcat |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10006430 |
ttatcttatatgtcgtgtttagtcaatgtaatttttgtgggctaccagcctaccactgatgtatattcaaatagttggagggtgttgtttgcttttgcat |
10006331 |
T |
 |
| Q |
218 |
tttattcatgttttttgcctttgctt |
243 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
10006330 |
tttattcatgttttttgcttttgctt |
10006305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University