View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_46 (Length: 304)
Name: NF3162_high_46
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 218
Target Start/End: Original strand, 23522280 - 23522496
Alignment:
| Q |
2 |
gtgggtagataatactattgagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
101 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522280 |
gtgggtatatactactatagagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
23522379 |
T |
|
| Q |
102 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgtccatccatagatgtaatgtaagagtccccaccttttccttcccctctctg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522380 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgtccatccatagatgtaatgtaagagtccccaccttttccttcccctctctg |
23522479 |
T |
|
| Q |
202 |
ttttataggtcccacca |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23522480 |
ttttataggtcccacca |
23522496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University