View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_47 (Length: 299)
Name: NF3162_high_47
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 289
Target Start/End: Complemental strand, 41706511 - 41706245
Alignment:
| Q |
23 |
ccgccatctttcccctcccatccaccgtctcattcaacgcttccaccgnnnnnnnnnnnnnnnnnnnnnnntaggcgatattgaatcccttcaatacgac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41706511 |
ccgccatctttcccctcccatccaccgtctcattcaacgcttccaccgtcctcctccctcctcctcctccttaggcgatattgaatcccttcaatacgac |
41706412 |
T |
|
| Q |
123 |
tcaacatctttcgaaacaccactcacctacggtttagacgaatctatcatcaaaacaatcccattctttatctacacaactaaatacgaacaagaatctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41706411 |
tcaacatctttcgaaacaccactcacctacggtttagacgaatctatcatcaaaacaatcccattctttatctacacaactaaatacgaacaagaatctc |
41706312 |
T |
|
| Q |
223 |
gccgtgactgtgccgtttgtttactcgaatttgaagatcacgattacgttcgtactcttcctctctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41706311 |
gccgtgactgtgccgtttgtttactcgaatttgaagatcacgattacgttcgtactcttcctctctg |
41706245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University