View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_52 (Length: 288)
Name: NF3162_high_52
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 2508445 - 2508175
Alignment:
| Q |
1 |
aagtccaaggtagtggtgattgattctttgcaatcgtgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaaagtttgaatgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508445 |
aagtccaaggtagtggtgattgattctttgcaatcatgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaaagtttgaatgttt |
2508346 |
T |
|
| Q |
101 |
ttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttctttaaggattgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
2508345 |
ttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttctttaagggtagag |
2508246 |
T |
|
| Q |
201 |
tattattggattgattgatagatatattcttatattttttgtattttgtgcgatggatcttagattgttgt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508245 |
tattattggattgattgatagatatattcttatattttttgtattttgtgcgatggatcttagattgttgt |
2508175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University