View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_81 (Length: 237)
Name: NF3162_high_81
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_81 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 28531251 - 28531036
Alignment:
| Q |
8 |
cagcagagacatagattccataacgaaaaccattcggagaaggattcaaacaagcaatggcatctgaattgttgttccacataactgatgtttggtctga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28531251 |
cagcagtgacatagattccataacgaaaaccattcggagaaggattcaaacaagcaatggcatctgaattgttgttccacataactgatgtttggtctga |
28531152 |
T |
|
| Q |
108 |
taactggtaagttccattacgaccatggccgcagtcaatgatatcaatgcatcctttgatgtttgacttattgcaagcatctctcaaacattgatttacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28531151 |
taactggtaagttccattacgaccatggccgcagtcaatgatatcaatgcatcctttgatgtttgacttattgcaagcatctctcaaacattgatttacc |
28531052 |
T |
|
| Q |
208 |
ctctaaaagaagaaag |
223 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
28531051 |
ctctaaaataagaaag |
28531036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University