View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_86 (Length: 236)
Name: NF3162_high_86
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 38582375 - 38582297
Alignment:
| Q |
21 |
taaaactaggagactttaattatggattggtggattctttgaggcaggtgtgtaatccattgtatccaacaagtcatca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582375 |
taaaactaggagactttaattatggattggtggattctttgaggcaggtgtgtaatccattgtatccaacaagtcatca |
38582297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 138 - 221
Target Start/End: Complemental strand, 38582258 - 38582175
Alignment:
| Q |
138 |
cccttcatggtttagcttaaacaagctactttgacccttttcttctccatctttagtatctctcaagtttctagctgcaagata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38582258 |
cccttcatggtttagcttaaacaagctactttgacccttttcatctccatcattagtatctctcaagtttctagctgcaagata |
38582175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University