View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_87 (Length: 235)
Name: NF3162_high_87
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_87 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 37 - 221
Target Start/End: Complemental strand, 477848 - 477665
Alignment:
| Q |
37 |
gttgaccaaccaaatatactcagtttattattattatcgtggatcaggttgctatttataaacaacacgtttgagatgagaatatattattttattaagt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
477848 |
gttgaccaaccaaatatactcagtttattattattatcgtggatcaggttgctatttataaacaacacgtttgagatgagaatatattattttattaagt |
477749 |
T |
|
| Q |
137 |
aaaaaatatgaattgcaataacttagggaatgtcacgatgatttccatcgtgcatgnnnnnnnattataccactagagtattttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
477748 |
caaaaatatgaattgcaataacttagggaatgtcacgatgatttccatcgtgcatg-ttttttattataccactagagtattttt |
477665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University