View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_89 (Length: 232)
Name: NF3162_high_89
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_89 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0022 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 22 - 220
Target Start/End: Original strand, 123532 - 123730
Alignment:
| Q |
22 |
acggtagcaggaatcaagtttttaattcgttgtaacaattgctgttgcatcgtggtccttgctattgggaggttgacaatcaaatgtaactggttcgacc |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123532 |
acggtagcaggaatcaagtttttaaatcgttgtaacaattgctgttgcatcgtggtccttgctattgggaggttgacaatcaaatgtaactggttcgacc |
123631 |
T |
 |
| Q |
122 |
tcaatatggtcacgaatacatcaaaaacctagattttttggcacacatgttcgttctcttttctgtgtactatatgcatattcttattttctctctctg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
123632 |
tcaatatggtcacgaatacatcaaaaacctagattttgtggcacacatgtttgttctcttttccgtgtactatatgcatattcttattttctttctctg |
123730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 55 - 208
Target Start/End: Complemental strand, 17332297 - 17332139
Alignment:
| Q |
55 |
aacaattgctgttgcatcgtggtccttgctattgggaggttgacaatcaaatgtaactggttcgacctcaat-atggtcacg----aatacat-caaaaa |
148 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||| ||| ||||||||||||| |||||||| ||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
17332297 |
aacaattgcagttg-atcgtgatccttgctattgtgagaatgacaatcaaatgcaactggtttgacctcaatcatggtcacgaacaaatacataaaaaaa |
17332199 |
T |
 |
| Q |
149 |
cctagattttttggcacacatgttcgttctcttttctgtgtactatatgcatattcttat |
208 |
Q |
| |
|
|||||||||| |||||||| |||| | ||||||||| |||| |||||||||||||||| |
|
|
| T |
17332198 |
cctagattttgtggcacacctgttaggtctcttttccttgtatcatatgcatattcttat |
17332139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University