View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_high_91 (Length: 226)
Name: NF3162_high_91
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_high_91 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 39960854 - 39960682
Alignment:
| Q |
15 |
atgaagggagttttaaatacaaacaatttaagttcgnnnnnnntaaaatactagtacctcgtacttcnnnnnnnngaaggacagtacctcgtacctctat |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39960854 |
atgaaggaagttttaaatacaaacaatttaagttcgaaaaaaataaaatactagtacctcgtacttcttttttttgaaggacagtacctcgtacttctat |
39960755 |
T |
|
| Q |
115 |
ttacatataactcttctgtcgaatgaatcatagcacaacaatgaaccaatctttgcccgattaatatgtctcg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39960754 |
ttacatataactcttctgtcgaatgaatcatagcacaacaatgaaccaatctttgcgcgattaatatgtctcg |
39960682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University