View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_64 (Length: 266)
Name: NF3162_low_64
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 73 - 236
Target Start/End: Complemental strand, 50438920 - 50438757
Alignment:
| Q |
73 |
tatccctcttaatattattnnnnnnngagagaaggaatatgagtgcttgatttaacgaataaagttacatgcactaatttgtacaccatatgctaatttc |
172 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50438920 |
tatccctcttaatattattaaaaaaatagagaaggaatatgagtgcttgatttaacgaataaagttacatgcactaatttgtacaccatatgctaatttc |
50438821 |
T |
 |
| Q |
173 |
gtgttctagatttacggaaagaaaactttgcactaaattacacatcgagcctcaaagatacttg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50438820 |
gtgttctagatttacggaaagaaaactttgcactaaattacacatcgagcctcaaagatacttg |
50438757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 50439022 - 50438940
Alignment:
| Q |
1 |
atgtatttttcttcaagctatttcggtgttggattgtaagggtgttcccaccaccggtttagttgatcaacttatccctctta |
83 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439022 |
atgtatttttcttcaagctatctcggtgttggattgtaagggtgttcccaccaccggtttagttgatcaacttatccctctta |
50438940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University