View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_67 (Length: 259)
Name: NF3162_low_67
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 38552653 - 38552882
Alignment:
| Q |
16 |
atagggggattaaaattattgattaaaaacaagaggttccaacttccaagagaatatgaatcaacgtaaaaaagaaaacagagaatatgaatctggtagc |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
38552653 |
atagggggattaaaatgattgattaaaaacaagaggttccaacttccaagagaatatgaatcaacgtaaaaaagaaaacagaaaatatgaatccggtagc |
38552752 |
T |
|
| Q |
116 |
agttatggaaaggtggggagtggaggagaaaagggtgttcaataagttatggaagagttcggctccttcgaaggtggtcgcctttgcgtggaaagctcta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38552753 |
agttatggaaaggtggggagtggaggagaaaagggtgttcaataagttatggaagagtctggctctttcgaaggtggtcgcctttgcgtggaaagctcta |
38552852 |
T |
|
| Q |
216 |
cttaaccgggttctaactaaggacaacctt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38552853 |
cttaaccgggttctaactaaggacaacctt |
38552882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University