View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_75 (Length: 248)
Name: NF3162_low_75
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 50439462 - 50439265
Alignment:
| Q |
19 |
ggaatcccaaccaagtttaatgtagatgaagctcatagaaaaatgaatggcttttcagcttgtggagatttgcttagagactaccaatgtagtct----- |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439462 |
ggaatcccaaccaagtttaatgtagatgaagctcatagaaaaatgaatggcttttcagcttgtggagatttgcttagagactaccaatgtagtcttatac |
50439363 |
T |
|
| Q |
114 |
--------tattgtaatcttgctcgc-aaccattctcagtgtgctgagatgtaaagtttagttcatgccatgtgtattgctcgcaatcttcaccttga |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50439362 |
agggtttctattgtaatcttgctcgcaaaccattctcagtgtgctgagatgtaaagtttagttcatgccatgtgtattgctcacaatcttcaccttga |
50439265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 50439246 - 50439200
Alignment:
| Q |
202 |
agattctaccctaattgcaactgtttttaatcaatcaacctcaatct |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50439246 |
agattctactctaattgcaactgtttttaatcaatcagcctcaatct |
50439200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University