View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_78 (Length: 245)
Name: NF3162_low_78
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_78 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 32464388 - 32464158
Alignment:
| Q |
1 |
ttagcctccaccctcatattttaattttgnnnnnnnagaggcaca--gtatgatattatattacttctttttagcctccaccctcatattttatttagtc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32464388 |
ttagcctccaccctcatattttaattttgtttttttagaggcatatagtaggatattatattacttctttttagcctccaccctcatattttatttagtc |
32464289 |
T |
|
| Q |
99 |
cccctacccacccgagtcaacaagtcgccaacatggtcattgcttgcgtcttcaaacttgttgaaatctctcgttgacgccaccttcgatatttcccttc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32464288 |
cccctacccacccgagtcaacaagtcgccaacatggtcattgcttgcgtcttcaaacttgttgaaatctctcgttgacgccaccttcgatatttcccttc |
32464189 |
T |
|
| Q |
199 |
ttattcttctcttcatcacatatataaatac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32464188 |
ttattcttctcttcatcacatatataaatac |
32464158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 32464414 - 32464366
Alignment:
| Q |
44 |
cagtatgatattatattacttct-ttttagcctccaccctcatatttta |
91 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32464414 |
cagtatgctattatattactcccattttagcctccaccctcatatttta |
32464366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 32464491 - 32464443
Alignment:
| Q |
44 |
cagtatgatattatattacttct-ttttagcctccaccctcatatttta |
91 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32464491 |
cagtatgctattatattactcccattttagcctccaccctcatatttta |
32464443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University