View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_81 (Length: 237)
Name: NF3162_low_81
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5847824 - 5848044
Alignment:
| Q |
1 |
tgtagtcggaatgagattatgaagtatataccaagcaaagaaatttatttttaaaggaagcgccttatgtcaaattatatcgggagattcaagaatagtt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5847824 |
tgtagttggaatgagattatgaagtatataccaagcaaagagatttatttttaaaggaagcgccttatgtcaaattatatcgggagattcaagaatagtt |
5847923 |
T |
 |
| Q |
101 |
acatttttcaaatccgtcaagtagtgataagctcttttggctgcannnnnnngtgataaatgtaaatttcattgtcacgtgtcttccactccagcataca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
5847924 |
acatttttcaaatccgtcaagtagtgataagctcttttgactgcatttttttgtgatgaatgtaaatttcattgtcacatgtcttccactccaacataca |
5848023 |
T |
 |
| Q |
201 |
acacaatgttatttaacaaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5848024 |
acacaatgttatttaacaaag |
5848044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University