View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_82 (Length: 237)
Name: NF3162_low_82
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 126 - 222
Target Start/End: Original strand, 34201932 - 34202028
Alignment:
| Q |
126 |
gcttttgttgtagctaaatggagaatgagaaagagaaaaacaagaatgatggtgttttgatttttcattgtttagctcaagatgtttgtttgtttgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34201932 |
gcttttgttgtagctaaatggagaatgagaaagagaaaaacaagaatgatggtgttttgatttttcattgtttagctcaagatgtttgtttgtttgt |
34202028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 34201807 - 34201854
Alignment:
| Q |
1 |
ccatctttgatgttggagattcataggactttggattttggttactat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34201807 |
ccatctttgatgttggagattcataggactttggattttggttactat |
34201854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University