View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3162_low_85 (Length: 237)

Name: NF3162_low_85
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3162_low_85
NF3162_low_85
[»] chr8 (1 HSPs)
chr8 (1-221)||(6370757-6370977)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 6370977 - 6370757
Alignment:
1 tacattccaagagatgaattacttcacacagatgagagtttaatattcagtcaagagtttaacacctttcaagatgtgttgtcactcttcaatattcaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6370977 tacattccaagagatgaattacttcacacagatgagagtttaatattcagtcaagagtttaacacctttcaagatgtgttgtcactcttcaatattcaaa 6370878  T
101 ttaaccatggtcctgatatactaagtaaattcaacaaaacatcgaggtccaacgaactttccccaattaatgctaaatcagtggctaaaagttcaacgta 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6370877 ttaaccatggtactgatatactaagtaaattcaacaaaacatcgaggtccaacgaactttccccaattaatgctaaatcagtggctaaaagttcaacgta 6370778  T
201 tccaacaccacaagtaattgc 221  Q
    ||||||||||||||| |||||    
6370777 tccaacaccacaagtgattgc 6370757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University