View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_86 (Length: 237)
Name: NF3162_low_86
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_86 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 26147582 - 26147784
Alignment:
| Q |
20 |
gttttagacttttagatggtagggatcgttcttttaaagaaatacccttggatacctccgaagcagttttcctggttttgtcgatctgtcttaagtatat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26147582 |
gttttagacttttagatggtagggatcgttcttttaaagaaatatccttggatacctccaaagcagttttcctggttttgtcgatctgtcttaagtatat |
26147681 |
T |
|
| Q |
120 |
atgcaagtatccgaatagtggatgtcacaaaaaattatgttttgtgggagcaccgctctctgcggtttttgtttctaaccaaattgtttctagtctcctt |
219 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26147682 |
atgcaagtatctgaatagtggatgttacaaaaaattatgttttgtgggagcaccgctctctgcggtttttgtttttaaccaaattgtttctagtctcctt |
26147781 |
T |
|
| Q |
220 |
tat |
222 |
Q |
| |
|
||| |
|
|
| T |
26147782 |
tat |
26147784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 26063516 - 26063550
Alignment:
| Q |
20 |
gttttagacttttagatggtagggatcgttctttt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26063516 |
gttttagacttttagatggtagggatcgtgctttt |
26063550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 26083485 - 26083519
Alignment:
| Q |
20 |
gttttagacttttagatggtagggatcgttctttt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26083485 |
gttttagacttttagatggtagggatcgtgctttt |
26083519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University