View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_90 (Length: 234)
Name: NF3162_low_90
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_90 |
 | |
|
| [»] scaffold0929 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 6362956 - 6363188
Alignment:
| Q |
1 |
gttaatgatttgcttataatgcaagtaactaaccatgtgagtttgttacatagtatttggcctattcacatatcatacataggcaacaattttctatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362956 |
gttaatgatttgcttataatgcaagtaactaaccatgtgagtttgttacatagtatttggcctattcacatatcatacataggcaacaattttctatatc |
6363055 |
T |
|
| Q |
101 |
tacacttaatagaagaatcaatttgtttgacgttaatca------------attttacctattcacatattttaaagatacccaaccctataatttaagg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6363056 |
tacacttaatagaagaatcaatttgtttgacgttaatcaaactcaacggctattttacctattcacatattttaaagatacccaaccctataattttagg |
6363155 |
T |
|
| Q |
189 |
gagcgaattgagatctagtgctggtatgaatct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6363156 |
gagcgaattgagatctagtgctggtatgaatct |
6363188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0929 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: scaffold0929
Description:
Target: scaffold0929; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 140 - 222
Target Start/End: Original strand, 1690 - 1772
Alignment:
| Q |
140 |
attttacctattcacatattttaaagatacccaaccctataatttaagggagcgaattgagatctagtgctggtatgaatctg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
1690 |
attttacctattcacatactttaaagataccaaaccctattatttaagggagcgaattgagattaggtgctcgtatgaatctg |
1772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University