View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3162_low_92 (Length: 232)

Name: NF3162_low_92
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3162_low_92
NF3162_low_92
[»] chr4 (2 HSPs)
chr4 (126-217)||(54338350-54338441)
chr4 (18-61)||(54338512-54338555)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 217
Target Start/End: Complemental strand, 54338441 - 54338350
Alignment:
126 gtagttactcagcaagagatcgtttctctttaccagcgtttctgtcagcttgatcgcaacaactgtggtttcattccttccgatgaatttct 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54338441 gtagttactcagcaagagatcgtttctctttaccagcgtttctgtcagcttgatcgcaacaactgtggtttcattccttccgatgaatttct 54338350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 54338555 - 54338512
Alignment:
18 gaagttcaacaacactgcaaacacgcatgtaacgataacgatac 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
54338555 gaagttcaacaacactgcaaacacgcatgtaacgataacgatac 54338512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University