View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_92 (Length: 232)
Name: NF3162_low_92
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 217
Target Start/End: Complemental strand, 54338441 - 54338350
Alignment:
| Q |
126 |
gtagttactcagcaagagatcgtttctctttaccagcgtttctgtcagcttgatcgcaacaactgtggtttcattccttccgatgaatttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54338441 |
gtagttactcagcaagagatcgtttctctttaccagcgtttctgtcagcttgatcgcaacaactgtggtttcattccttccgatgaatttct |
54338350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 54338555 - 54338512
Alignment:
| Q |
18 |
gaagttcaacaacactgcaaacacgcatgtaacgataacgatac |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54338555 |
gaagttcaacaacactgcaaacacgcatgtaacgataacgatac |
54338512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University