View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_97 (Length: 221)
Name: NF3162_low_97
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 55320344 - 55320154
Alignment:
| Q |
20 |
tttcataacaagtgatacttacttacacaaagctatattttgctttcttgataaatttggttcctcctgtgaatgattgttggagcagttatttgcatgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55320344 |
tttcataacaagtgatacttacttacacaaagctatattttgctttcttgataaatttggttcgtcctgtgaatgattgttggagcagttatttgcatgg |
55320245 |
T |
 |
| Q |
120 |
aatcacaaggtatactatatagtgttgtgtttgtgccttttggttctatttttatggcgaggttgcttttcatgtccacttgcctttgcta |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55320244 |
aatcacagggtatactatatagtgttgtgtttgtgccttttggttctatttttatggcgaggttgcttttcatgtccacttgcctttgcta |
55320154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 20 - 182
Target Start/End: Complemental strand, 31951441 - 31951279
Alignment:
| Q |
20 |
tttcataacaagtgatacttacttacacaaagctatattttgctttcttgataaatttggttcctcctgtgaatgattgttggagcagttatttgcatgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951441 |
tttcataacaagtgatacttacttacacaaagctatattttgctttcttgatagatttggttcctcctgtgaatgattgttggagcagttatttgcatgg |
31951342 |
T |
 |
| Q |
120 |
aatcacaaggtatactatatagtgttgtgtttgtgccttttggttctatttttatggcgaggt |
182 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951341 |
aatcataaggtatactatatagtgttgtgtttgtgccttttggttctatttttatggcgaggt |
31951279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 2778066 - 2778252
Alignment:
| Q |
20 |
tttcataacaagtgatacttacttacacaaagctatattttgctttcttgataaatttggttcctcctgtgaatgattgttggagcagttatttgcatgt |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778066 |
tttcatgacaagtgatacttacttacacaaagctatattttgctttcttgatagttttgtatcctcctgtgaatgattgttggagcagttatttgcatgg |
2778165 |
T |
 |
| Q |
120 |
aatcacaaggtatactatatagtgttgtgtttgtgccttttggttctatttttatggcgaggttgcttttcatgtccacttgccttt |
206 |
Q |
| |
|
|||||||||||||| | || ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2778166 |
aatcacaaggtataatttacagtgttgcgtttgtgccttttggttctatttttatggcgaggctgcttttcatgtccacttgccttt |
2778252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University