View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3162_low_98 (Length: 221)
Name: NF3162_low_98
Description: NF3162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3162_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 9500592 - 9500781
Alignment:
| Q |
20 |
agattaaaccaatctccacccttcagctaaagtgaaacttgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500592 |
agattaaaccaatctccacccttcagctaaagtgaaacttgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttg |
9500691 |
T |
 |
| Q |
120 |
ctacattgataaatactgtgtttggatgtatcactggcttgtcaattttattgcttgacaattaaaatatgattctacttcccacaggtt |
209 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9500692 |
ctacaatgataaatactatgtttggaagtatcactggcttgtcaattttattgcttgacaattaaaatatgattctacttcccataggtt |
9500781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University