View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3164_high_13 (Length: 407)

Name: NF3164_high_13
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3164_high_13
NF3164_high_13
[»] chr4 (2 HSPs)
chr4 (205-407)||(1119641-1119832)
chr4 (18-131)||(1119906-1120019)
[»] chr5 (1 HSPs)
chr5 (72-131)||(20284850-20284909)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 205 - 407
Target Start/End: Complemental strand, 1119832 - 1119641
Alignment:
205 gatgcatgtttaaatcaaacttgattcgtcaatttaccnnnnnnnnngtgttaattaatgaacacgggttttgtttttgtgctgacacggttcagattat 304  Q
    ||||||||||||||||||||||||||| ||||||||||         || |||| ||||||||||||||||||||||||||||||||| ||||||| |||    
1119832 gatgcatgtttaaatcaaacttgattcatcaatttaccaaaaaaaa-gttttaactaatgaacacgggttttgtttttgtgctgacacagttcagactat 1119734  T
305 acaatctgaacagtattttaccagttcgtattctataatccaaattatgtcaaattatgaactgcaattgatttttgaaacccaacaaaaatatatttca 404  Q
    ||||||||||||||||||||||||||| |||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||    
1119733 acaatctgaacagtattttaccagttcatattctataatccaaat----------tatgaactgcaattgatttttgaaacccaacaaaaatatatttca 1119644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 1120019 - 1119906
Alignment:
18 ggaggcagcggggtggtaggggtgaccatgatactcggtagttttatgactctgttttaaaatttggataatttatgcttggaccttttgttgtaacctt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
1120019 ggaggcagcggggtggtaggggtgaccatgatactcggtagttttatgactctgttgtaaaatttggataatttatgcttggaccttttgttgtaacctt 1119920  T
118 tggatattggtgat 131  Q
    ||||||||||||||    
1119919 tggatattggtgat 1119906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 72 - 131
Target Start/End: Complemental strand, 20284909 - 20284850
Alignment:
72 ttttaaaatttggataatttatgcttggaccttttgttgtaacctttggatattggtgat 131  Q
    |||||| ||||| |||||||||| | | | ||||||||||||||||||||||||||||||    
20284909 ttttaacatttgtataatttatgttagaatcttttgttgtaacctttggatattggtgat 20284850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University