View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_high_13 (Length: 407)
Name: NF3164_high_13
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_high_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 205 - 407
Target Start/End: Complemental strand, 1119832 - 1119641
Alignment:
| Q |
205 |
gatgcatgtttaaatcaaacttgattcgtcaatttaccnnnnnnnnngtgttaattaatgaacacgggttttgtttttgtgctgacacggttcagattat |
304 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| || |||| ||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
1119832 |
gatgcatgtttaaatcaaacttgattcatcaatttaccaaaaaaaa-gttttaactaatgaacacgggttttgtttttgtgctgacacagttcagactat |
1119734 |
T |
 |
| Q |
305 |
acaatctgaacagtattttaccagttcgtattctataatccaaattatgtcaaattatgaactgcaattgatttttgaaacccaacaaaaatatatttca |
404 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1119733 |
acaatctgaacagtattttaccagttcatattctataatccaaat----------tatgaactgcaattgatttttgaaacccaacaaaaatatatttca |
1119644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 1120019 - 1119906
Alignment:
| Q |
18 |
ggaggcagcggggtggtaggggtgaccatgatactcggtagttttatgactctgttttaaaatttggataatttatgcttggaccttttgttgtaacctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1120019 |
ggaggcagcggggtggtaggggtgaccatgatactcggtagttttatgactctgttgtaaaatttggataatttatgcttggaccttttgttgtaacctt |
1119920 |
T |
 |
| Q |
118 |
tggatattggtgat |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1119919 |
tggatattggtgat |
1119906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 72 - 131
Target Start/End: Complemental strand, 20284909 - 20284850
Alignment:
| Q |
72 |
ttttaaaatttggataatttatgcttggaccttttgttgtaacctttggatattggtgat |
131 |
Q |
| |
|
|||||| ||||| |||||||||| | | | |||||||||||||||||||||||||||||| |
|
|
| T |
20284909 |
ttttaacatttgtataatttatgttagaatcttttgttgtaacctttggatattggtgat |
20284850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University