View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_high_17 (Length: 371)
Name: NF3164_high_17
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 79 - 350
Target Start/End: Complemental strand, 782823 - 782551
Alignment:
| Q |
79 |
tgatgcttatttgtgtgagtgagagtgaatgatgaaaa-tgaataatattagtaaacaaaagtttgtatggatttttagcatttgaatgtgtggtgtgag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782823 |
tgatgcttatttgtgtgagtgagagtgaatgatgaaaaatgaataatattagtatacaaaagtttgtatggatttttagcatttgaatgtgtggtgtgag |
782724 |
T |
 |
| Q |
178 |
tttaggtatatggataaggtgatatggtttggaccaattacattttatgattttgattcgatgtctctatctaacccaaacttccaacatctttgccaat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782723 |
tttaggtatatggataaggtgatatggtttggaccaattacattttatgattttgattcgatgtctctatctaacccaaacttccaacatctttgccaat |
782624 |
T |
 |
| Q |
278 |
tttcatcttgcttttgtagttttctggttaataataagatgcacctttaattttggttgatttatttacttta |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782623 |
tttcatcttgcttttgtagttttctggttaataataagatgcacctttaattttggttgatttatttacttta |
782551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 50
Target Start/End: Complemental strand, 43590837 - 43590802
Alignment:
| Q |
15 |
gagatgaagaggaggagcgttgatgttactgcggcg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43590837 |
gagatgaagaggaggagcgttgatgttactgcggcg |
43590802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University