View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_high_25 (Length: 334)
Name: NF3164_high_25
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 315
Target Start/End: Complemental strand, 4271519 - 4271223
Alignment:
| Q |
14 |
tgagatgaagctaggatgacagaaaactatattacgatgatacaaataaatcaagattattagtcatt-gctagaacaacaagctggtacaaaagattaa |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
4271519 |
tgagatgaagctaagatgacagaaaactatattacgatgatacaaataaatcaagattattagtcatttgctagaat------ctggtacaaaagattaa |
4271426 |
T |
 |
| Q |
113 |
cggaacagttatcgcaaacaaacacatgacgttcggtaatgaagttcagccaattgtgtctatatctccgactacaaagtagcggcaattatattttatt |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4271425 |
cggaacagttatcacaaacaaacacatgacgttcggtaatgaagttcagccaaatgtgtctatgtctccgactacaaagtagcggcaattatgttttatt |
4271326 |
T |
 |
| Q |
213 |
atttgcgaaagattttggtttacagtgaactgtaatgtgggacatttgcatcccacaccctcagtcgcccccacaacaaaaaattggaccagatgctcat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4271325 |
atttgcgaaagattttggtttacagtgaactgtaatgtgggacctttgcctcccacaccctcagtcgcccccacaacaaaaaattggaccaaatgttcat |
4271226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 133 - 192
Target Start/End: Complemental strand, 31592893 - 31592834
Alignment:
| Q |
133 |
aacacatgacgttcggtaatgaagttcagccaattgtgtctatatctccgactacaaagt |
192 |
Q |
| |
|
||||||||| ||| ||| ||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31592893 |
aacacatgatgtttggttatgaagttcggccaattgtgtctatctctccaactacaaagt |
31592834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University