View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_high_35 (Length: 251)
Name: NF3164_high_35
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_high_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 49498232 - 49497990
Alignment:
| Q |
10 |
agatgaacgtagtcaaaaacttgcaaaaagtatgaaacatattaataataagagttttgttaacggatgtcctaaatatatttgttaaagagtttatcga |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
49498232 |
agatgaatatagtcaaaaacttgcaaaaagtatgaaacatattaataataagagttttgttaactgatgtcctaaatatatttattaaagagtttatcga |
49498133 |
T |
 |
| Q |
110 |
aagaaattttatcttgaaaatacatatcgttgcttttattaacgtaataaatacacaactaacacatttaagttggtatgatggcg-ttgtttaagacat |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||||| || ||| |||||| |
|
|
| T |
49498132 |
aagaaattttatcttaaaaatacatatcgttacttttattaatgtaataaatacacaactaacccatttaggttggtatgatggcgtttatttgagacat |
49498033 |
T |
 |
| Q |
209 |
ttgaattttgaagtgcgctctttttaaaatttgaatttcgatt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||| ||||||| |
|
|
| T |
49498032 |
ttgaattttgaagtgcgctctgtttaagatctgaagttcgatt |
49497990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University