View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_high_51 (Length: 226)
Name: NF3164_high_51
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_high_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 6824704 - 6824929
Alignment:
| Q |
1 |
tccatcaatctatataactctcgtttccaaaaacaacgcgccaatgaaaaactcttcaggagtcataatcacttttgcaagataggtaaaggttacgagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6824704 |
tccatcaatctatataactctcgtttccaaaaacaacgcgccaatgaaaaactcttcatgagtcataatcacttttgcaagataggtaaaggttacgagt |
6824803 |
T |
 |
| Q |
101 |
tatatgaggttgtttccgctagatttcagttaagaggaaaacgatatgccgttaattccgttaccacaaacacgtcgcatccaatttaaccttccagcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6824804 |
tatatgaggttgtttccgctagatttcagttaagaggaaaacgatatgccgttaattccgttaccacaaacacgtcgcatccaatttaaccttcccgcaa |
6824903 |
T |
 |
| Q |
201 |
ataacgccttcaccaatcaaccaaaa |
226 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
6824904 |
ataacgccttcaaaaatcaaccaaaa |
6824929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University