View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_20 (Length: 356)
Name: NF3164_low_20
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 7196005 - 7196337
Alignment:
| Q |
19 |
gatgagtctaattcaaagattccacaaatggaagatcacaaggtgagttcaacaaatagtactcatagttcatcaccaccttctgatcattgtcatcttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7196005 |
gatgagtctaattcaaagattccacaaatggaagatcacaaggtgagttcaacaaatagtactcatagttcatcatcaccttctgatcattgtcatcttt |
7196104 |
T |
 |
| Q |
119 |
tagcagagaaatttgatcctcaagagatccttttggatgtggagcttaagaagatggcttcctttcttggacttgaaaatgattgaagtgatttattcca |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196105 |
tagcagagaaatttgaccctcaagagatccttttggatgtggagcttaagaagatggcttcctttcttggacttgaaaatgattgaagtgatttattcca |
7196204 |
T |
 |
| Q |
219 |
atgatgggaccaagagaaaaaggtcaagtgaattgggaatcatatagcctttgctatatgccatttttatatgtatttcctaactaaacatgtaactaga |
318 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196205 |
atgaggggaccaagagaaaaaggtcaagtgaattgggaatcatatagcctttgctatatgccatttttatatgtatttcctaactaaacatgtaactaga |
7196304 |
T |
 |
| Q |
319 |
tgaacaagttcttggcttcttcttcatctcact |
351 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |
|
|
| T |
7196305 |
tgaacaagttcttggcttcttctttatgtcact |
7196337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University