View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_21 (Length: 350)
Name: NF3164_low_21
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 22380034 - 22379703
Alignment:
| Q |
1 |
attaaacatattctgtctctacaaatgcagccatcatacataaccactctctccacattttatcatggctcctccatgggttcaagaactccctctcaat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22380034 |
attaaacaaattctgtctctacaaatgcaaccatcagacataaccactctcaccacattttatcatggctcctccatgggttcaagaactccctctcaat |
22379935 |
T |
 |
| Q |
101 |
cctttgaatattccagtcaccattatcaacacattctccgttactccatcgaagcctattcctgtcaaaccaggtgactgtttatatctttcaaacctcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22379934 |
cctttgaatattccagtcaccattatcaacacattctccgttactccatcgaagcctattcctgtcaaaccaggtgactgtttatatctttcaaacctcg |
22379835 |
T |
 |
| Q |
201 |
atgacgtgattggagcacgcgtcttcacaccgacggtttacttttatcaatcagacaattcaagtacgtctttccaaaaaccggtcgcggaaatacttgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22379834 |
atgacgtgattggagcacgcgtcttcacaccgacggtttacttttatcaatcagacaattcaagtacgtctttccaaaaaccggtcgcggaaatacttgg |
22379735 |
T |
 |
| Q |
301 |
ccgcgctctagctgacgttttggttccctact |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22379734 |
ccgcgctctagctgacgttttggttccctact |
22379703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University