View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_31 (Length: 278)
Name: NF3164_low_31
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 48310703 - 48310435
Alignment:
| Q |
18 |
gttttgataatgcatatatatttggttcgagtaatatatatcacttgtttttcttatcacacattgacttcttcatctctcaaaccaaatatatatgcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48310703 |
gttttgataatgcatatatatttggttcgagtaatatatatcacctgtttttctcatcacacattgacttcttcatctctcaaaccaaatatatatgctt |
48310604 |
T |
 |
| Q |
118 |
tatcagaccattgtattactcgaacatcaaaatattgacatcgtata--------tttatcttttaaaaaatatttaacgtcttatttggcaacaaatat |
209 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
48310603 |
tatcaaaacattgtattactcgaacatcaaaatattgacatcgtatatatttatctttatctcttaaaaaatatttgacgttttatttggcaacaaatat |
48310504 |
T |
 |
| Q |
210 |
tttatgtctaaacatcatttctcttataaaaacttgttctataaaatatgatctagcataaatgagctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48310503 |
tttatgtctaaacatcatttctcttataaaaacttgttctataaaatatgatctagcataaatgagctt |
48310435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University