View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_34 (Length: 258)
Name: NF3164_low_34
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 83 - 224
Target Start/End: Complemental strand, 348493 - 348353
Alignment:
| Q |
83 |
gggaataaggaatttaagttgaagatttgagaatatgacaggnnnnnnngggggaaaaccgattacaagggagttatagatgattctttnnnnnnnnnca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
348493 |
gggaataaggaatttaagttgaagatttgagaatatgataggaaaaaaaggggaaaaaccgattacaagggagttatagatgattcttt-aaaaaaacca |
348395 |
T |
|
| Q |
183 |
aaagggagttatagatgatacaaaatgttatgattattcttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
348394 |
aaagggagttatagatgatacaaaatgttatgattattcttt |
348353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 348558 - 348524
Alignment:
| Q |
18 |
atcaaagcattgtaacgataccattgttcataatg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
348558 |
atcaaagcattgtaacgataccattgttcataatg |
348524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University