View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_48 (Length: 238)
Name: NF3164_low_48
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 26414706 - 26414916
Alignment:
| Q |
11 |
tacttaggaccatacatcctcccacgcacatcttccaatattccataaggatatgaaacttacatgtctgccaatgttgaagtcatcttacttatcttga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414706 |
tacttaggaccatacatcctcccacgcacatcttccaatattccataaggatatgaaacttacatgtctgccaatgttgaagtcatcttacttatcttga |
26414805 |
T |
|
| Q |
111 |
ttccccgagatctaactttatcatcgaaaatggcataaggccaatgcttgatcccatgtcgcataagtacttattcaccttaaatttcccaatattgcag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414806 |
ttccccgagatctaactttatcatcgaaaatggcataaggccaatgcttgatcccatgtcgcataagtacttattcaccttaaatttcccaatattgcag |
26414905 |
T |
|
| Q |
211 |
agagagtatac |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
26414906 |
agagagtatac |
26414916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University