View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3164_low_52 (Length: 233)
Name: NF3164_low_52
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3164_low_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 4058681 - 4058478
Alignment:
| Q |
16 |
aatatttaacaacccagctaaaactttaattcaacttcaaaataaaatcaatcagtttgcatagttaatttcaaattaatctctactacaatctctacgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058681 |
aatatttaacaacccagctaaaactttaattcaacttcaaaataaaatcaatcagtttgcatagttaatttcaaattaatctctactacaatctctacgg |
4058582 |
T |
 |
| Q |
116 |
ccatggacttggagaccatgtttggattacaaacttcatatccaatcaaacaatgagaatttctcgtggaattagcaagaaaacttcgaaatggcttata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058581 |
ccatggacttggagaccatgtttggattacaaacttcatatccaatcaaacaatgagaatttctcgtggaattagcaagaaaacttcgaaatggcttata |
4058482 |
T |
 |
| Q |
216 |
tatg |
219 |
Q |
| |
|
|||| |
|
|
| T |
4058481 |
tatg |
4058478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University