View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3164_low_52 (Length: 233)

Name: NF3164_low_52
Description: NF3164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3164_low_52
NF3164_low_52
[»] chr6 (1 HSPs)
chr6 (16-219)||(4058478-4058681)


Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 4058681 - 4058478
Alignment:
16 aatatttaacaacccagctaaaactttaattcaacttcaaaataaaatcaatcagtttgcatagttaatttcaaattaatctctactacaatctctacgg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4058681 aatatttaacaacccagctaaaactttaattcaacttcaaaataaaatcaatcagtttgcatagttaatttcaaattaatctctactacaatctctacgg 4058582  T
116 ccatggacttggagaccatgtttggattacaaacttcatatccaatcaaacaatgagaatttctcgtggaattagcaagaaaacttcgaaatggcttata 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4058581 ccatggacttggagaccatgtttggattacaaacttcatatccaatcaaacaatgagaatttctcgtggaattagcaagaaaacttcgaaatggcttata 4058482  T
216 tatg 219  Q
    ||||    
4058481 tatg 4058478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University