View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3167_low_3 (Length: 358)
Name: NF3167_low_3
Description: NF3167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3167_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 5 - 355
Target Start/End: Complemental strand, 25310961 - 25310609
Alignment:
| Q |
5 |
accatttctttagaaccaacctccttttctaaaaccagtgataatccaccagttataataactttagacccttaatgctattactagagaaggaaatcta |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25310961 |
accattcctttagaaccaacctccttttctaaaaccagtgataatccaccagttacaataactttagacccttaatgctattactagagaaggaaatcta |
25310862 |
T |
 |
| Q |
105 |
attaattttccatgcaacaaactgaaaaagttattcatggcaacaagtatttaagagatcttttcttggtgagactatccttttcttattgcaatgatga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25310861 |
attaattttccatgcaacaaactgaaaaagttattcatgacaacaaatatttaagagatcttttcttgttgagactatccttttcttattgcaatgatga |
25310762 |
T |
 |
| Q |
205 |
aacatatccgacacattttcagatg--acagccctgtgttatatccacaaagacagcnnnnnnnnnnnnnnnnnngaggagtatagtatctcatactttt |
302 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
25310761 |
aacatatccgacacattttcagatgatacagcccagtgatatatccacgaagacagcaaaaaaagaaaagaaaattaggagtatagtatctcatactttt |
25310662 |
T |
 |
| Q |
303 |
tcttcagtgtcatcaggacgggttactagccttgctttgatttcatctctctc |
355 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| ||| |||| |
|
|
| T |
25310661 |
tcttcagtgtcatcaggacgagttactagccttgcttttatttcttctgtctc |
25310609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University