View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3170_low_11 (Length: 258)
Name: NF3170_low_11
Description: NF3170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3170_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 5365908 - 5366109
Alignment:
| Q |
20 |
cttcggtcattcgagagaataaggcttggagaaaatatgcagctagtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365908 |
cttcggtcattcgagagaataaggcttggagaaaatatgcagctagtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgag |
5366007 |
T |
|
| Q |
120 |
ttgttgtaaacgagtgctgnnnnnnnctgctatggctcgtgctgtttcgaggaggatgttgttggcccactttccggttaattcgaaggtgaaatcagct |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5366008 |
ttgttgtaaacgagtgctgtttttttctgctatggctcgtgctgtttcgaggaggatgttgttggcccaccttccggttaattcgaaggtgaaatcagct |
5366107 |
T |
|
| Q |
220 |
gt |
221 |
Q |
| |
|
|| |
|
|
| T |
5366108 |
gt |
5366109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 64 - 125
Target Start/End: Complemental strand, 39987382 - 39987321
Alignment:
| Q |
64 |
agtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgagttgttg |
125 |
Q |
| |
|
|||||||| ||| |||||||||| |||| || || ||||| |||||||||||||||||||| |
|
|
| T |
39987382 |
agtttttgatctgtgtcaccatatggggtactaagctcgtttagcatccacatgagttgttg |
39987321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University