View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3170_low_15 (Length: 242)
Name: NF3170_low_15
Description: NF3170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3170_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 58 - 201
Target Start/End: Complemental strand, 46812021 - 46811878
Alignment:
| Q |
58 |
gttgaaaaattacacttacacaaactcttcacttctgtttaaatatatcccttaccaagagtccaatccgtaatcttatcgattttatagtgaatgtagt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46812021 |
gttgaaaaattacacttacacaaactcttcacttctgtttaaatatatcccttaccaagagtccaatccgtaatcttatcggttttatagtgaatgtagt |
46811922 |
T |
 |
| Q |
158 |
gtttgctgttgctgaaaacagagatgttatagtttggcatagtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46811921 |
gtttgctgttgctgaaaacagagatgttatagtttggcatagtg |
46811878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 33573345 - 33573312
Alignment:
| Q |
8 |
atatattattatattttgtcaactttctaatatt |
41 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
33573345 |
atatattattatatttggtcaactttctaatatt |
33573312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University