View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3172_high_4 (Length: 253)
Name: NF3172_high_4
Description: NF3172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3172_high_4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 32 - 253
Target Start/End: Original strand, 182161 - 182375
Alignment:
| Q |
32 |
gttgattgaatattgaaaaatatgaagtgtacaaa-tatgattgatgtcgagaacaatgatttaatggtacgtgattaattgaatattacaactaactaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182161 |
gttgattgaatattgaaaaatatgaagtgtacaaaatatcattgatgtcgacaacaatgatttaatggtacgtgattaattgaatattacaactaactaa |
182260 |
T |
 |
| Q |
131 |
caaacaacacactcttcaattctgtcattctcattctgtgtgcagaagcacaattttaaatttattattattaatataatatgcaacttggtttttgacc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
182261 |
caaacaacacactcttcaattctgtcatcctcattctgtgtgcagaagcacaattttaaatttattat--------taatatgcaacttggtttttgacc |
182352 |
T |
 |
| Q |
231 |
ataaatattaacattaaccacac |
253 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
182353 |
ataaatattaacattaaccacac |
182375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University