View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3172_low_5 (Length: 234)
Name: NF3172_low_5
Description: NF3172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3172_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 24578936 - 24579075
Alignment:
| Q |
19 |
ttagaaacatcaattacctcagaaatttcagtcttctcttcctttgaagactcttgagaggtttttgaaagacagctagaaggcaaaactttgttgatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24578936 |
ttagaaacatcaattacctcagaaatttcagtcttctcttcctttgaagactcctgagaggtttttggaagacagctagaaggcaaaactttgttgatta |
24579035 |
T |
|
| Q |
119 |
tctcttggtttttggtaggagtactactttgctgctgctg |
158 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
24579036 |
tctcttgttttttggtatgagtactactttgctgctgctg |
24579075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University